US 12,486,502 B2
RNAi agents for inhibiting expression of receptor for advanced glycation end-products, compositions thereof, and methods of use
Anthony Nicholas, Oregon, WI (US); Erik W. Bush, Verona, WI (US); David Itiro Kasahara, Madison, WI (US); and Casi M. Schienebeck, Deerfield, WI (US)
Assigned to Arrowhead Pharmaceuticals, Inc., Pasadena, CA (US)
Filed by Arrowhead Pharmaceuticals, Inc., Pasadena, CA (US)
Filed on Apr. 7, 2022, as Appl. No. 17/715,444.
Claims priority of provisional application 63/322,603, filed on Mar. 22, 2022.
Claims priority of provisional application 63/172,301, filed on Apr. 8, 2021.
Prior Publication US 2022/0396791 A1, Dec. 15, 2022
Int. Cl. C12N 15/113 (2010.01); A61K 9/00 (2006.01); A61P 11/00 (2006.01)
CPC C12N 15/113 (2013.01) [A61K 9/0073 (2013.01); A61P 11/00 (2018.01); C12N 2310/11 (2013.01); C12N 2310/14 (2013.01)] 13 Claims
 
1. An RNAi agent for inhibiting expression of a Receptor for Advanced Glycation End-products gene, comprising:
an antisense strand wherein nucleotides 1 through 21 (5′→3′) of the antisense strand comprise the nucleotide sequence UGAUGUUUUGAGCACCUACUC (SEQ ID NO:9) (5′ →3′); and
a sense strand comprising the modified nucleotide sequence:
gsaguagGfuGfcUfcaaaacauca (SEQ ID NO:14) (5′→3′);
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; and s represents a phosphorothioate linkage;
wherein at least one nucleotide of the antisense strand is a modified nucleotide or includes a modified internucleoside linkage.