| CPC C12N 15/113 (2013.01) [A61K 9/0073 (2013.01); A61P 11/00 (2018.01); C12N 2310/11 (2013.01); C12N 2310/14 (2013.01)] | 13 Claims |
|
1. An RNAi agent for inhibiting expression of a Receptor for Advanced Glycation End-products gene, comprising:
an antisense strand wherein nucleotides 1 through 21 (5′→3′) of the antisense strand comprise the nucleotide sequence UGAUGUUUUGAGCACCUACUC (SEQ ID NO:9) (5′ →3′); and
a sense strand comprising the modified nucleotide sequence:
gsaguagGfuGfcUfcaaaacauca (SEQ ID NO:14) (5′→3′);
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; and s represents a phosphorothioate linkage;
wherein at least one nucleotide of the antisense strand is a modified nucleotide or includes a modified internucleoside linkage.
|