| CPC C12Q 1/6844 (2013.01) [C12Q 1/04 (2013.01); C12Q 1/689 (2013.01)] | 7 Claims |
|
1. A primer set for amplifying a nucleotide sequence of a Mycoplasma pneumoniae dnaE gene, comprising an internal primer set with the following nucleotide sequences a) and b), and also external primer set comprising the following nucleotide sequences c) and d):
a) 5 ‘ACGGCATTATTGTGGAAGTG 3’ (SEQ ID NO: 3) or a nucleotide sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:3-linked at a 5′ end by a TTTT bridge to the sequence 5′ CAGCTAAAAACAACTCATCCCAGTC 3′ (SEQ ID NO: 5) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 5,
b) 5′ CGCTCATCAAAGCCCTTG 3′ (SEQ ID NO: 4) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 4 linked at a 5′ end by TTTT bridge to the sequence 5′ TGCGGTTAAAGCTAAGACTCACAG 3′ (SEQ ID NO: 6) or resulting from a single nucleotide change, single nucleotide substitution or single nucleotide deletion of SEQ ID NO:6,
c) 5′ GCTATTACAAGAGTTAAACGCAC 3′ (SEQ ID NO: 1) or resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 1, and
d) 5′ GTCGATAACTTTATTGACGGTAA 3′ (SEQ ID NO: 2) or resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 2.
|