US 12,467,083 B2
Primer sets for detection of mycoplasma pneumoniae bacteria, method for detection of mycoplasma pneumoaniae infection, use of a primer set for detection of mycoplasma pneumoniae infection
Miron Tokarski, Brzeg (PL); Izabela Piekla, Konopiska (PL); and Malgorzata Malodobra-Mazur, Wroclaw (PL)
Assigned to GENOMTEC S.A., Wroclaw (PL)
Appl. No. 17/905,572
Filed by GENOMTEC S.A., Wroclaw (PL)
PCT Filed Mar. 17, 2021, PCT No. PCT/PL2021/050016
§ 371(c)(1), (2) Date Sep. 2, 2022,
PCT Pub. No. WO2021/187994, PCT Pub. Date Sep. 23, 2021.
Claims priority of application No. 433269 (PL), filed on Mar. 17, 2020.
Prior Publication US 2023/0125922 A1, Apr. 27, 2023
Int. Cl. C12Q 1/6844 (2018.01); C12Q 1/04 (2006.01); C12Q 1/689 (2018.01)
CPC C12Q 1/6844 (2013.01) [C12Q 1/04 (2013.01); C12Q 1/689 (2013.01)] 7 Claims
 
1. A primer set for amplifying a nucleotide sequence of a Mycoplasma pneumoniae dnaE gene, comprising an internal primer set with the following nucleotide sequences a) and b), and also external primer set comprising the following nucleotide sequences c) and d):
a) 5 ‘ACGGCATTATTGTGGAAGTG 3’ (SEQ ID NO: 3) or a nucleotide sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:3-linked at a 5′ end by a TTTT bridge to the sequence 5′ CAGCTAAAAACAACTCATCCCAGTC 3′ (SEQ ID NO: 5) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 5,
b) 5′ CGCTCATCAAAGCCCTTG 3′ (SEQ ID NO: 4) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 4 linked at a 5′ end by TTTT bridge to the sequence 5′ TGCGGTTAAAGCTAAGACTCACAG 3′ (SEQ ID NO: 6) or resulting from a single nucleotide change, single nucleotide substitution or single nucleotide deletion of SEQ ID NO:6,
c) 5′ GCTATTACAAGAGTTAAACGCAC 3′ (SEQ ID NO: 1) or resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 1, and
d) 5′ GTCGATAACTTTATTGACGGTAA 3′ (SEQ ID NO: 2) or resulting from a single nucleotide exchange, single nucleotide substitution or single nucleotide deletion of SEQ ID NO: 2.