CPC A61K 38/50 (2013.01) [A61K 31/7088 (2013.01); A61K 38/465 (2013.01); C12N 9/22 (2013.01); C12N 9/78 (2013.01); C12N 15/102 (2013.01); C12N 15/11 (2013.01); C12N 15/907 (2013.01); C12N 2310/20 (2017.05); C12N 2800/80 (2013.01)] | 4 Claims |
1. A method of editing a β-globin (HBB) polynucleotide comprising a single nucleotide polymorphism (SNP) associated with sickle cell disease, wherein the SNP associated with sickle cell disease results in expression of an HBB polypeptide having a valine at amino acid position 7 of SEO ID NO: 37, the method comprising contacting the HBB polynucleotide with a base editor in complex with one or more single guide RNAs (sgRNAs), wherein the base editor comprises a Streptococcus pyogenes Cas9 polynucleotide programmable DNA binding domain having specificity for a protospacer-adjacent motif comprising the nucleic acid sequence 5′-NGC-3′ and an adenosine deaminase domain, wherein the one or more guide polynucleotides target the base editor to effect an A•T to G•C alteration of the SNP associated with sickle cell disease, thereby substituting an alanine for the valine at amino acid position 7 referenced to SEO ID NO: 37, wherein the first and the last three bases of the one or more sgRNAs are phosphorothioate and 2′-O-methyl modified, and wherein the one or more sgRNAs comprise a spacer complementary to an HBB nucleic acid sequence corresponding to the target sequence ACTTCTCCACAGGAGTCAGA (positions 1-20 of SEO ID NO: 251) and adjacent to a protospacer-adjacent motif comprising the nucleic acid sequence 5′-NGC-3′.
|