US 12,442,002 B2
RNAi agents for inhibiting expression of activin receptor-like kinase 7 (ALK7), compositions thereof, and methods of use
Michelle Ngai, Fitchburg, WI (US); Mark Majewski, Rockton, IL (US); Zhi-Ming Ding, Waunakee, WI (US); Agnieszka Glebocka, Madison, WI (US); Tao Pei, Middleton, WI (US); James C. Hamilton, Sierra Madre, CA (US); and Grigoriy Shekhtman, Los Angeles, CA (US)
Assigned to Arrowhead Pharmaceuticals, Inc., Pasadena, CA (US)
Filed by Arrowhead Pharmaceuticals, Inc., Pasadena, CA (US)
Filed on Dec. 19, 2024, as Appl. No. 18/988,719.
Claims priority of provisional application 63/683,214, filed on Aug. 14, 2024.
Claims priority of provisional application 63/634,860, filed on Apr. 16, 2024.
Claims priority of provisional application 63/612,531, filed on Dec. 20, 2023.
Prior Publication US 2025/0207139 A1, Jun. 26, 2025
Int. Cl. C12N 15/113 (2010.01)
CPC C12N 15/1137 (2013.01) [C12Y 207/1103 (2013.01); C12N 2310/14 (2013.01); C12N 2310/312 (2013.01); C12N 2310/321 (2013.01); C12N 2310/322 (2013.01); C12N 2320/35 (2013.01)] 19 Claims
 
1. An RNAi agent for inhibiting expression of a Activin Receptor-Like Kinase 7 (ALK7) gene, comprising:
an antisense strand wherein nucleotides 1-21 of the antisense strand (5′→3′) comprise the nucleotide sequence (5′→3′): AUUGUUGGAACUAUGACAGAC (SEQ ID NO: 558); and
a sense strand that comprises a nucleotide sequence that differs by 0 or 1 nucleotides from the nucleotide sequence (5′→3′): GUCUGUCAUAGUUCCAACAAU (SEQ ID NO: 599);
wherein all of the nucleotides of the antisense strand and all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2′-fluoro modified nucleotides, 2′-O-methyl modified nucleotides, and cyclopropyl phosphonate-containing nucleotides, wherein the sense strand is linked to one or more lipid moieties, and wherein each of the one or more lipid moieties is independently selected from the group consisting of:

OG Complex Work Unit Chemistry
wherein custom character indicates the point of connection to the RNAi agent.