| CPC C12N 15/1137 (2013.01) [C12Y 207/1103 (2013.01); C12N 2310/14 (2013.01); C12N 2310/312 (2013.01); C12N 2310/321 (2013.01); C12N 2310/322 (2013.01); C12N 2320/35 (2013.01)] | 19 Claims |
|
1. An RNAi agent for inhibiting expression of a Activin Receptor-Like Kinase 7 (ALK7) gene, comprising:
an antisense strand wherein nucleotides 1-21 of the antisense strand (5′→3′) comprise the nucleotide sequence (5′→3′): AUUGUUGGAACUAUGACAGAC (SEQ ID NO: 558); and
a sense strand that comprises a nucleotide sequence that differs by 0 or 1 nucleotides from the nucleotide sequence (5′→3′): GUCUGUCAUAGUUCCAACAAU (SEQ ID NO: 599);
wherein all of the nucleotides of the antisense strand and all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2′-fluoro modified nucleotides, 2′-O-methyl modified nucleotides, and cyclopropyl phosphonate-containing nucleotides, wherein the sense strand is linked to one or more lipid moieties, and wherein each of the one or more lipid moieties is independently selected from the group consisting of:
![]() wherein
indicates the point of connection to the RNAi agent. |