US 12,415,001 B2
RNA-guided systems for in vivo gene editing
Amy J. Wagers, Cambridge, MA (US); Mohammadsharif Tabebordbar, Cambridge, MA (US); Wei Leong Chew, Boston, MA (US); and George M. Church, Brookline, MA (US)
Assigned to President and Fellows of Harvard College, Cambridge, MA (US)
Filed by President and Fellows of Harvard College, Cambridge, MA (US)
Filed on Dec. 23, 2022, as Appl. No. 18/145,996.
Application 18/145,996 is a continuation of application No. 16/834,339, filed on Mar. 30, 2020, granted, now 11,666,665.
Application 16/834,339 is a continuation of application No. 15/531,751, abandoned, previously published as PCT/US2015/063181, filed on Dec. 1, 2015.
Claims priority of provisional application 62/085,785, filed on Dec. 1, 2014.
Prior Publication US 2023/0211016 A1, Jul. 6, 2023
Int. Cl. A61K 48/00 (2006.01); C12N 9/22 (2006.01); C12N 15/10 (2006.01); C12N 15/11 (2006.01); C12N 15/86 (2006.01); C12N 15/90 (2006.01)
CPC A61K 48/005 (2013.01) [C12N 9/22 (2013.01); C12N 15/102 (2013.01); C12N 15/11 (2013.01); C12N 15/86 (2013.01); C12N 15/907 (2013.01); C12N 2310/20 (2017.05); C12N 2750/14143 (2013.01)] 16 Claims
OG exemplary drawing
 
1. A method of producing an altered dystrophin gene product in a eukaryotic cell within a mammal comprising
providing to the eukaryotic cell one or more nucleic acid molecules encoding two or more guide RNAs complementary to two or more target genomic dystrophin DNA sequences flanking one or more exons of exons 45-55 of a target dystrophin gene, and
wherein the one or more nucleic acid molecules encode a Cas9 protein,
wherein the one or more nucleic acid molecules are expressed in the eukaryotic cell,
wherein the two or more guide RNAs bind to the two or more sequences on the target dystrophin gene and the Cas9 protein cleaves at the two or more sequences thereby removing the one or more exons from the target dystrophin gene to produce an altered dystrophin gene,
wherein the two or more guide RNAs are each a tracrRNA-crRNA fusion comprising
(SEQ ID NO: 12)
NNNNNNNNNNNNNNNNNNNNGUUUAAGUACUCUGUGCUGGAAACAGCACA
 
GAAUCUACUUAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUG
 
GCGAGAUUUUUUU,
and
wherein the eukaryotic cell expresses the altered dystrophin gene to produce a truncated dystrophin polypeptide.