	US 12,077,830 B2
	Methods for detecting norovirus
Peter Lee, Tustin, CA (US); Raymond Huang, Cerritos, CA (US); Kristin Ramos, Carson, CA (US); Jules Chen, Irvine, CA (US); and Michelle Tabb, Santa Ana, CA (US)
Assigned to Quest Diagnostics Investments LLC, Secaucus, NJ (US)
Filed by Quest Diagnostics Investments LLC, Secaucus, NJ (US)
Filed on Jan. 13, 2023, as Appl. No. 18/097,004.
Application 18/097,004 is a division of application No. 17/063,078, filed on Oct. 5, 2020, granted, now 11,555,223.
Application 17/063,078 is a continuation of application No. 16/306,203, granted, now 10,793,924, previously published as PCT/US2017/035686, filed on Jun. 2, 2017.
Claims priority of provisional application 62/345,331, filed on Jun. 3, 2016.
Prior Publication US 2023/0279513 A1, Sep. 7, 2023
Int. Cl. C12Q 1/70 (2006.01); A61P 31/14 (2006.01); C12N 7/00 (2006.01); C12Q 1/68 (2018.01); C12Q 1/686 (2018.01); G01N 33/569 (2006.01); A61K 39/00 (2006.01)

CPC C12Q 1/701 (2013.01) [A61P 31/14 (2018.01); C12N 7/00 (2013.01); C12Q 1/68 (2013.01); C12Q 1/686 (2013.01); C12Q 1/70 (2013.01); G01N 33/56983 (2013.01); A61K 39/00 (2013.01); C12N 2770/16021 (2013.01); C12Q 2600/106 (2013.01); C12Q 2600/112 (2013.01); G01N 2333/08 (2013.01)]

13 Claims

1. A kit for detecting the presence of Norovirus genogroup I (GI) in a biological sample comprising a first primer pair that amplifies a Norovirus genogroup I (GI) target nucleic acid of SEQ ID NO: 2 or a complement thereof, wherein the first primer pair consists of a first forward primer comprising 5′d CGYTGGATGCGITTYCATGA 3′ (SEQ ID NO: 5) and a first reverse primer comprising 5′d TCCTTAGACGCCATCATCATTTAC 3′(SEQ ID NO: 6).