US 11,739,320 B2
Gene correction of Pompe disease and other autosomal recessive disorders via RNA-guided nucleases
Krishanu Saha, Middleton, WI (US); Jared Matthew Carlson-Stevermer, Burlingame, CA (US); and Lucille Katherine Kohlenberg, Elm Grove, WI (US)
Assigned to WISCONSIN ALUMNI RESEARCH FOUNDATION, Madison, WI (US)
Filed by Wisconsin Alumni Research Foundation, Madison, WI (US)
Filed on Nov. 5, 2019, as Appl. No. 16/674,448.
Claims priority of provisional application 62/755,980, filed on Nov. 5, 2018.
Prior Publication US 2020/0140858 A1, May 7, 2020
Int. Cl. C12N 15/11 (2006.01); C12N 9/22 (2006.01); A61P 3/00 (2006.01); A61K 35/545 (2015.01); C12N 15/86 (2006.01); A61K 31/7088 (2006.01)
CPC C12N 15/11 (2013.01) [A61K 31/7088 (2013.01); A61K 35/545 (2013.01); A61P 3/00 (2018.01); C12N 9/22 (2013.01); C12N 15/86 (2013.01); C12N 2310/20 (2017.05); C12N 2310/351 (2013.01); C12N 2800/80 (2013.01)] 21 Claims
 
1. A modified guide RNA, comprising
a crRNA comprising, a single-stranded protospacer sequence and a first complementary strand of a binding region for the Cas9 polypeptide, and
a tracrRNA comprising a second complementary strand of the binding region for the Cas9 polypeptide,
wherein the crRNA or the tracrRNA comprises an aptamer that binds an avidin molecule,
wherein the crRNA and the tracrRNA hybridize through the first and second complementary strands of the binding region for the Cas9 polypeptide,
wherein the single stranded protospacer region comprises
 
 (SEQ ID NO: 1)
 
 CTCGTTGTCCAGGTAGGCCC, 
 
 
 
 (SEQ ID NO: 2)
 
 TGGACCACCAGCTCCTGTAG,
 
 
 
 (SEQ ID NO: 60)
 
 GGACCACCAGCTCCTGTAGG,
 
 
 
 (SEQ ID NO: 61)
 
 GCCCAGGAAGCCGCAGACGT,
 
 or
 
 
 
 (SEQ ID NO: 62)
 
 CAGAGGAGCTGTGTGTGCAC.
 
5. A guide RNA, comprising
a crRNA comprising, a single-stranded protospacer sequence and a first complementary strand of a binding region for the Cas9 polypeptide, and
a tracrRNA comprising a second complementary strand of the binding region for the Cas9 polypeptide,
wherein the crRNA and the tracrRNA hybridize through the first and second complementary strands of the binding region for the Cas9 polypeptide,
wherein the single stranded protospacer region comprises
 
 (SEQ ID NO: 1)
 
 CTCGTTGTCCAGGTAGGCCC,
 
 
 
 (SEQ ID NO: 2)
 
 TGGACCACCAGCTCCTGTAG,
 
 
 
 (SEQ ID NO: 60)
 
 GGACCACCAGCTCCTGTAGG,
 
 
 
 (SEQ ID NO: 61)
 
 GCCCAGGAAGCCGCAGACGT,
 
 or
 
 
 
 (SEQ ID NO: 62)
 
 CAGAGGAGCTGTGTGTGCAC.
 
6. A method of modifying an acid-α-glucosidase (GAA) gene ex vivo in a patient-derived cell, wherein the patient has -Pompe disease, the method comprising
delivering to the cell a first modified guide RNA, a second modified guide RNA, a Cas9 polypeptide having nuclease activity, an avidin molecule, a first biotinylated donor polynucleotide, and a second biotinylated donor polynucleotide, wherein each modified guide RNA comprises,
a crRNA comprising, a single-stranded protospacer sequence and a first complementary strand of a binding region for the Cas9 polypeptide, and
a tracrRNA comprising a second complementary strand of the binding region for the Cas9 polypeptide,
wherein the crRNA or the tracrRNA comprises an aptamer that binds an avidin molecule,
wherein the crRNA and the tracrRNA hybridize through the first and second complementary strands of the binding region for the Cas9 polypeptide,
wherein the single-stranded protospacer sequence of the modified guide RNA hybridizes to a sequence in the GAA gene,
wherein the first modified guide RNA and the first biotinylated donor polynucleotide correct a first diseased allele,
wherein the second modified guide RNA and the second biotinylated donor polynucleotide correct a second diseased allele.
 
18. A method of modifying an acid-α-glucosidase (GAA) gene ex vivo in a patient-derived cell, wherein the patient has Pompe disease, the method comprising
delivering to the cell a first modified guide RNA, a second modified guide RNA, a Cas9 polypeptide with nuclease activity, an avidin molecule, a first biotinylated donor polynucleotide, and a second biotinylated donor polynucleotide, wherein each modified guide RNA comprises,
a crRNA comprising, a single-stranded protospacer sequence and a first complementary strand of a binding region for the Cas9 polypeptide, and
a tracrRNA comprising a second complementary strand of the binding region for the Cas9 polypeptide,
wherein the crRNA or the tracrRNA comprises an aptamer that binds an avidin molecule,
wherein the crRNA and the tracrRNA hybridize through the first and second complementary strands of the binding region for the Cas9 polypeptide,
wherein the single-stranded protospacer sequence of the modified guide RNA hybridizes to a sequence in the GAA gene,
wherein the first modified guide RNA and the first biotinylated donor polynucleotide correct a first diseased allele,
wherein the second modified guide RNA and the second biotinylated donor polynucleotide correct a second diseased allele,
wherein the single stranded protospacer region of the first modified guide RNA comprises CTCGTTGTCCAGGTAGGCCC (SEQ ID NO: 1) and the single stranded protospacer region of the second guide RNA comprises TGGACCACCAGCTCCTGTA (SEQ ID NO: 2).
 
20. A method of modifying an acid-α-glucosidase (GAA) in a patient-derived cell, wherein the patient has Pompe disease, the method comprising
delivering to the cell a first guide RNA, a second guide RNA, a Cas9 polypeptide with nuclease activity, a first donor polynucleotide, and a second donor polynucleotide, wherein each guide RNA comprises,
a crRNA comprising, a single-stranded protospacer sequence and a first complementary strand of a binding region for the Cas9 polypeptide, and
a tracrRNA comprising a second complementary strand of the binding region for the Cas9 polypeptide,
wherein the crRNA and the tracrRNA hybridize through the first and second complementary strands of the binding region for the Cas9 polypeptide,
wherein the single-stranded protospacer sequence of the modified guide RNA hybridizes to a sequence in the GAA gene,
wherein the first guide RNA and the first donor polynucleotide correct a first diseased allele,
wherein the second guide RNA and the second donor polynucleotide correct a second diseased allele,
wherein the single stranded protospacer region of the first modified guide RNA comprises CTCGTTGTCCAGGTAGGCCC (SEQ ID NO: 1) and the single stranded protospacer region of the second guide RNA comprises TGGACCACCAGCTCCTGTA (SEQ ID NO: 2).