| CPC C12N 7/045 (2013.01) [C12N 15/1031 (2013.01); C12N 2710/16721 (2013.01)] | 4 Claims |
|
1. A gE protein-deleted pseudorabies virus (PRV) strain, the gE protein-deleted PRV strain being deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: V202323; and the gE protein-deleted PRV strain being constructed using an adenine base editor (ABE); (ABE) and
wherein the gE protein-deleted PRV strain is constructed using a process comprising:
(1), constructing an sgRNA backbone plasmid, comprising:
designing an sgRNA sequence having the sequence set forth in SEQ ID NO: 2, using the ABE with a start codon of the gE gene in a PRV as a target site, synthesizing two single-stranded oligonucleotides according to the sgRNA sequence, annealing the single-stranded oligonucleotides to obtain a double-stranded DNA fragment with sticky ends, digesting a vector with a restriction endonuclease and recovering a resulting enzyme-digested fragment, and then ligating the enzyme-digested fragment to the double-stranded DNA fragment with sticky ends to obtain a ligation product, namely an sgRNA expression vector; wherein the single-stranded oligonucleotide has the sequences set forth in SEQ ID NO: 3 or SEQ ID NO: 4:
NG-ABE8e-gE-F: CACCGGCCGCATGGTCTCAACCCC (SEQ ID NO: 3);
NG-ABE8e-gE-R: AAACGGGGTTGAGACCATGCGGCC (SEQ ID NO: 4);
the vector has the sequence set forth in SEQ ID NO: 11;
the restriction endonuclease is a BbsI enzyme; and
transforming the ligation product into a competent cell to allow plate screening and culture, selecting a resulting positive bacterial strain to allow expanded culture, and extracting a resulting plasmid from a resulting positive bacterial solution; and
(2), transfection of the plasmid, comprising:
introducing the plasmid into a Vero81 cell, culturing the Vero81 cell to logarithmic growth phase at 37° C. and 5% (v/v) CO2, collecting a resulting virus liquid, and centrifuging the virus liquid to collect a resulting supernatant;
wherein the adenine base editor is NG-ABE8e; and
wherein a base at position 2 of a start codon in the gE gene of wild-type PRV is mutated from T to C to obtain a resulting mutated gE gene; wherein the resulting mutated gE gene is set forth in SEQ ID NO: 1.
|