	US 11,697,813 B2
	Pharmaceutical compositions and methods of use for activation of human fibroblast and myofibroblast apoptosis
John Xu, Germantown, MD (US); Patrick Y. Lu, Potomac, MD (US); Jia Zhou, Gaithersburg, MD (US); Qingfeng Li, Shanghai (CN); and Vera Simonenko, Gaithersburg, MD (US)
Assigned to Sirnaomics, Inc., Germantown, MD (US); and Sirnaomics Medicine Technology (Suzhou) Co, Ltd., Suzhou (CN)
Appl. No. 16/343,309
Filed by Sirnaomics, Inc., Gaithersburg, MD (US); Jia Zhou, Gaithersburg, MD (US); and Qingfeng Li, Gaithersburg, MD (US)
PCT Filed Oct. 30, 2017, PCT No. PCT/US2017/059072 § 371(c)(1), (2) Date Apr. 18, 2019, PCT Pub. No. WO2018/081726, PCT Pub. Date May 3, 2018.
Claims priority of provisional application 62/414,780, filed on Oct. 30, 2016.
Prior Publication US 2020/0392507 A1, Dec. 17, 2020
Int. Cl. C07H 21/02 (2006.01); C07H 21/04 (2006.01); C12N 15/113 (2010.01); A61K 31/713 (2006.01); A61K 47/34 (2017.01)

CPC C12N 15/1136 (2013.01) [A61K 31/713 (2013.01); A61K 47/34 (2013.01); C12N 15/1137 (2013.01); C12N 2310/14 (2013.01); C12N 2320/30 (2013.01)]

11 Claims

1. A method of reducing fibrosis in the tissue of a mammal, comprising administering to the tissue a therapeutically effective amount of a composition comprising an siRNA molecule that binds to an mRNA that codes for TGF-β1 protein in a mammalian cell, an siRNA molecule that binds to an mRNA that codes for COX-2 protein in a mammalian cell, and a pharmaceutically acceptable carrier comprising a pharmaceutically acceptable histidine-lysine co-polymer,

wherein said composition comprises the siRNA molecule hmTF-25-2: sense, 5′-r(CCCAAGGGCUACCAUGCCAACUUCU)-3′ (SEQ ID NO: 1), antisense, 5′-r(AGAAGUUGGCAUGGUAGCCCUUGGG)-3′ (SEQ ID NO: 2), and the siRNA molecule hmCX-25-1: sense, 5′-r(GGUCUGGUGCCUGGUCUGAUGAUGU)-3′ (SEQ ID NO: 3), antisense, 5′-r(ACAUCAUCAGACCAGGCACCAGACC)-3′ (SEQ ID NO: 4).