US 12,319,916 B2
Modulation of gene transcription using antisense oligonucleotides targeting regulatory RNAs
Alfica Sehgal, Belmont, MA (US); Bryan J. Matthews, Somerville, MA (US); David A. Bumcrot, Belmont, MA (US); Justin A. Caravella, Cambridge, MA (US); Mario Esteban Contreras Gamboa, Cambridge, MA (US); Rachana S. Kelkar, Malden, MA (US); Yun Joon Jung, Lexington, MA (US); Yuting Liu, Lexington, MA (US); Rutuja Sudhakar Pai, Charlestown, MA (US); Subhadeep Roy, Lafayette, CO (US); and Yuchun Guo, Framingham, MA (US)
Assigned to CAMP4 Therapeutics Corporation, Cambridge, MA (US)
Filed by Camp4 Therapeutics Corporation, Cambridge, MA (US)
Filed on Jun. 24, 2024, as Appl. No. 18/752,290.
Application 18/752,290 is a continuation of application No. PCT/US2022/082295, filed on Dec. 22, 2022.
Claims priority of provisional application 63/308,373, filed on Feb. 9, 2022.
Claims priority of provisional application 63/292,920, filed on Dec. 22, 2021.
Prior Publication US 2024/0336924 A1, Oct. 10, 2024
Int. Cl. C12N 15/11 (2006.01); A61P 13/00 (2006.01); C12N 15/113 (2010.01)
CPC C12N 15/1137 (2013.01) [A61P 13/00 (2018.01); C12Y 603/04016 (2013.01); C12N 2310/113 (2013.01); C12N 2310/315 (2013.01); C12N 2310/3231 (2013.01); C12N 2310/3341 (2013.01); C12N 2310/341 (2013.01); C12N 2310/351 (2013.01); C12N 2310/3525 (2013.01)] 15 Claims
 
1. An antisense oligonucleotide (ASO) comprising a nucleotide sequence of TGCAGGCACACACATCAGGC (SEQ ID NO: 1), wherein one or more of the nucleotides of the ASO are chemically modified.