CPC C12N 15/113 (2013.01) [A61K 47/549 (2017.08); A61K 47/554 (2017.08); A61K 47/59 (2017.08); C12N 2310/141 (2013.01); C12N 2310/321 (2013.01); C12N 2310/3515 (2013.01)] | 16 Claims |
1. A composition for the treatment of bladder fibrosis in a patient in need, the composition comprising an miR-29 mimic, the miR-29 mimic comprising a working RNA strand comprising the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5).
|