US 11,987,793 B2
Compositions and methods for prevention of bladder fibrosis
Jianghui Hou, St. Louis, MO (US); Dale Bjorling, Madison, WI (US); and Zunyi Wang, Madison, WI (US)
Assigned to Washington University, St. Louis, MO (US); and Wisconsin Alumni Research Foundation, Madison, WI (US)
Filed by Washington University, St. Louis, MO (US); and Wisconsin Alumni Research Foundation, Madison, WI (US)
Filed on May 3, 2021, as Appl. No. 17/306,929.
Claims priority of provisional application 63/019,425, filed on May 3, 2020.
Prior Publication US 2021/0340538 A1, Nov. 4, 2021
This patent is subject to a terminal disclaimer.
Int. Cl. C12N 15/113 (2010.01); A61K 47/54 (2017.01); A61K 47/59 (2017.01)
CPC C12N 15/113 (2013.01) [A61K 47/549 (2017.08); A61K 47/554 (2017.08); A61K 47/59 (2017.08); C12N 2310/141 (2013.01); C12N 2310/321 (2013.01); C12N 2310/3515 (2013.01)] 16 Claims
OG exemplary drawing
 
1. A composition for the treatment of bladder fibrosis in a patient in need, the composition comprising an miR-29 mimic, the miR-29 mimic comprising a working RNA strand comprising the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5).