	US 12,286,629 B2
	Compositions and methods for treating endometriosis
Hugh Taylor, Easton, CT (US)
Assigned to YALE UNIVERSITY
Appl. No. 17/258,879
Filed by YALE UNIVERSITY, New Haven, CT (US)
PCT Filed Jul. 12, 2019, PCT No. PCT/US2019/041532 § 371(c)(1), (2) Date Jan. 8, 2021, PCT Pub. No. WO2020/014566, PCT Pub. Date Jan. 16, 2020.
Claims priority of provisional application 62/697,457, filed on Jul. 13, 2018.
Prior Publication US 2021/0324385 A1, Oct. 21, 2021
Int. Cl. C12N 15/113 (2010.01); A61P 15/00 (2006.01)

CPC C12N 15/1137 (2013.01) [A61P 15/00 (2018.01); C12N 2310/141 (2013.01); C12N 2310/531 (2013.01)]

1 Claim

1. A method of treating endometriosis in a subject with endometriosis, comprising administering to the subject an effective amount of an activator of a let-7 microRNA (miRNA), wherein the activator is a let-7b mimic comprising the sequence UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO:9), and wherein the activator is administered to the subject by intraperitoneal injections every three days for two weeks.