| CPC C12N 15/86 (2013.01) [C12N 9/22 (2013.01); C12N 9/96 (2013.01); C12N 2310/20 (2017.05); C12N 2750/14143 (2013.01)] | 33 Claims |
|
1. An engineered polynucleotide comprising:
a multiplexed guide sequence cassette comprising a nucleotide sequence encoding two or more Cas12a guide sequences and two or more Cas12a direct repeat (DR) sequences, wherein each guide sequence has a Cas12a DR sequence 5′ of the guide sequence, wherein each Cas12a DR sequence is different, wherein at least one Cas12a DR sequence comprises a mutated Cas12a DR sequence relative to a wildtype Cas12a DR sequence, wherein the wildtype Cas12a DR sequence is TAATTTCTACTCTTGTAGAT (SEQ ID NO: 25), wherein the at least one mutated Cas12a DR sequence comprises a mutation at position 1, 6, 9, 12, 14, 16, 19, or any combination thereof, relative to SEQ ID NO: 25, wherein each mutated Cas12a DR sequence comprises at least one of:
(i) A or G at position 1;
(ii) A, G, or T at position 12;
(iii) A, G, or C at position 14;
(iv) C at position 6 and G at position 19; and
(v) C at position 9 and G at position 16, and
wherein the multiplexed guide sequence cassette is capable of directing equal or greater multiplexing activity of a Cas12a protein, a homologue thereof, or an orthologue thereof, to one or more target polynucleotides that the two or more Cas12a guide sequences target, as compared to a control multiplexed guide sequence cassette comprising only the wildtype Cas12a DR sequence.
|