US 12,264,323 B2
CRISPR CPF1 direct repeat variants
John G. Doench, Cambridge, MA (US); and Ruth Hanna, Cambridge, MA (US)
Assigned to THE BROAD INSTITUTE, INC., Cambridge, MA (US)
Filed by THE BROAD INSTITUTE, INC., Cambridge, MA (US)
Filed on Dec. 17, 2019, as Appl. No. 16/718,155.
Claims priority of provisional application 62/780,748, filed on Dec. 17, 2018.
Claims priority of provisional application 62/884,101, filed on Aug. 7, 2019.
Prior Publication US 2020/0255861 A1, Aug. 13, 2020
Int. Cl. C12N 15/86 (2006.01); C12N 9/22 (2006.01); C12N 9/96 (2006.01)
CPC C12N 15/86 (2013.01) [C12N 9/22 (2013.01); C12N 9/96 (2013.01); C12N 2310/20 (2017.05); C12N 2750/14143 (2013.01)] 33 Claims
 
1. An engineered polynucleotide comprising:
a multiplexed guide sequence cassette comprising a nucleotide sequence encoding two or more Cas12a guide sequences and two or more Cas12a direct repeat (DR) sequences, wherein each guide sequence has a Cas12a DR sequence 5′ of the guide sequence, wherein each Cas12a DR sequence is different, wherein at least one Cas12a DR sequence comprises a mutated Cas12a DR sequence relative to a wildtype Cas12a DR sequence, wherein the wildtype Cas12a DR sequence is TAATTTCTACTCTTGTAGAT (SEQ ID NO: 25), wherein the at least one mutated Cas12a DR sequence comprises a mutation at position 1, 6, 9, 12, 14, 16, 19, or any combination thereof, relative to SEQ ID NO: 25, wherein each mutated Cas12a DR sequence comprises at least one of:
(i) A or G at position 1;
(ii) A, G, or T at position 12;
(iii) A, G, or C at position 14;
(iv) C at position 6 and G at position 19; and
(v) C at position 9 and G at position 16, and
wherein the multiplexed guide sequence cassette is capable of directing equal or greater multiplexing activity of a Cas12a protein, a homologue thereof, or an orthologue thereof, to one or more target polynucleotides that the two or more Cas12a guide sequences target, as compared to a control multiplexed guide sequence cassette comprising only the wildtype Cas12a DR sequence.