US 11,926,869 B2
Development of simple sequence repeat (SSR) core primer group based on whole genome sequence of pomegranate and application thereof
Gaihua Qin, Hefei (CN); Yiliu Xu, Hefei (CN); Chunyan Liu, Hefei (CN); and Jiyu Li, Hefei (CN)
Assigned to INSTITUTE OF HORTICULTURE RESEARCH, ANHUI ACADEMY OF AGRICULTURAL SCIENCE, Hefei (CN)
Filed by Institute of Horticulture Research, Anhui Academy of Agricultural Science, Hefei (CN)
Filed on Jul. 30, 2022, as Appl. No. 17/877,908.
Application 17/877,908 is a continuation of application No. 16/926,735, filed on Jul. 12, 2020, abandoned.
Claims priority of application No. 201910631857.6 (CN), filed on Jul. 12, 2019.
Prior Publication US 2023/0069872 A1, Mar. 9, 2023
Int. Cl. C12Q 1/6858 (2018.01); C12Q 1/6895 (2018.01)
CPC C12Q 1/6858 (2013.01) [C12Q 1/6895 (2013.01); C12Q 2531/113 (2013.01); C12Q 2565/125 (2013.01); C12Q 2600/156 (2013.01)] 3 Claims
 
1. A method for identifying a variety of a plant of a genus pomegranate, the method comprising:
extracting DNA from the plant;
conducting a polymerase chain reaction (PCR) using the extracted DNA and a Simple Sequence Repeat (SSR) primer group comprising 11 primer pairs, the 11 primer pairs comprise PG080. PG130, PG139, PG152, PG153, PG140, PG098, PG070, PG077, PG090, and PG093, wherein nucleotide sequences of each of the 11 primer pairs are as follows:
 
Sequence
 
 
ID Primer Forward primer
 
 1 PG080 ctgactgttgcagagagtaggctg
 
 3 PG130 ctcatatggcgattctctgtcctt
 
 5 PG139 gtttccttccctcaacccaaaa
 
 7 PG152 catcagaatcgtccccttgtg
 
 9 PG153 gtgtttgatgctcccatttcattt
 
11 PG140 caagaaagtgtgtgagcgattgat
 
13 PG098 tgccttcttaaggacttcaccaac
 
15 PG070 cacctctgcttcagcaaacaaata
 
17 PG077 gtcagtctcctccttcttcaatgg
 
19 PG090 attcttttatactaaccaaaatttgcga
 
21 PG093 cgtcaataggacgtccctgagata
 
Sequence
 
 
ID Primer Reverse primer
 
 2 PG080 aggaggtgaaacaacgaatagctg
 
 4 PG130 aagttcgataaattgcactggtgg
 
 6 PG139 agtgggattttaccaagtcgaaca
 
 8 PG152 cagagagaagaagagagaccgagc
 
10 PG153 gccttcaacggtctttcttcttct
 
12 PG140 ccaaaccttacccctctctctctc
 
14 PG098 ctaacctcatgcacttgtcatcca
 
16 PG070 caactcaacacaatatccaaccca
 
18 PG077 agacgaagcacctgagaaggaat
 
20 PG090 atgtcatgagaggacccacaaa
 
22 PG093 gatgacgtggcagagtaagagagc;
 
obtaining amplified DNA products;
analyzing SSR polymorphisms of the amplified DNA products; and
identifying the variety of the plant based on the polymorphic amplified DNA products.