	US 12,227,746 B2
	Compounds and methods for modulating SCN2A
Paymaan Jafar-Nejad, Carlsbad, CA (US)
Assigned to Ionis Pharmaceuticals, Inc., Carlsbad, CA (US)
Filed by Ionis Pharmaceuticals, Inc., Carlsbad, CA (US)
Filed on Oct. 10, 2023, as Appl. No. 18/483,663.
Application 18/483,663 is a continuation of application No. 18/017,276, abandoned, previously published as PCT/US2021/044887, filed on Aug. 6, 2021.
Claims priority of provisional application 63/063,120, filed on Aug. 7, 2020.
Prior Publication US 2024/0102012 A1, Mar. 28, 2024
Int. Cl. C12N 15/113 (2010.01); A61P 25/00 (2006.01)

CPC C12N 15/113 (2013.01) [A61P 25/00 (2018.01); C12N 2310/11 (2013.01); C12N 2310/315 (2013.01); C12N 2310/322 (2013.01); C12N 2310/3231 (2013.01); C12N 2310/341 (2013.01)]

26 Claims

1. An oligomeric compound comprising a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 2510);

wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides;

wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages; and

wherein each cytosine is a 5-methyl cytosine.