	US 12,203,074 B2
	Compositions and methods for treatment of dominant retinitis pigmentosa
Alfred S. Lewin, Gainesville, FL (US); William W. Hauswirth, Gainesville, FL (US); Michael T. Massengill, Gainesville, FL (US); William Beltran, Wynnewood, PA (US); Gustavo D. Aguirre, Media, PA (US); Artur Cideciyan, Lafayette Hill, PA (US); and Samuel Jacobson, Penn Valley, PA (US)
Assigned to University of Florida Research Foundation, Incorporated, Gainesville, FL (US); and The Trustees of the University of Pennsylvania, Philadelphia, PA (US)
Appl. No. 17/059,815
Filed by University of Florida Research Foundation, Incorporated, Gainesville, FL (US); and The Trustees of the University of Pennsylvania, Philadelphia, PA (US)
PCT Filed Jun. 3, 2019, PCT No. PCT/US2019/035159 § 371(c)(1), (2) Date Nov. 30, 2020, PCT Pub. No. WO2019/232517, PCT Pub. Date Dec. 5, 2019.
Claims priority of provisional application 62/809,539, filed on Feb. 22, 2019.
Claims priority of provisional application 62/679,585, filed on Jun. 1, 2018.
Prior Publication US 2021/0207147 A1, Jul. 8, 2021
Int. Cl. C12N 15/113 (2010.01); C12N 15/86 (2006.01)

CPC C12N 15/1138 (2013.01) [C12N 15/86 (2013.01); C12N 2310/121 (2013.01); C12N 2310/122 (2013.01); C12N 2310/14 (2013.01); C12N 2320/32 (2013.01); C12N 2750/14142 (2013.01); C12N 2750/14143 (2013.01)]

20 Claims

1. A short hairpin RNA (shRNA) comprising the nucleotide sequence: GUGGCAUUCUACAUCUUCAUUCAAGAGAUGAAGAUGUAGAAUGCCAC (SEQ ID NO: 4).