US 10,889,820 B2
Fidgetin-like 2 as a target to enhance wound healing
David J. Sharp, Scarsdale, NY (US); and Rabab Charafeddine, San Francisco, CA (US)
Assigned to ALBERT EINSTEIN COLLEGE OF MEDICINE
Filed by ALBERT EINSTEIN COLLEGE OF MEDICINE, Bronx, NY (US)
Filed on Dec. 10, 2019, as Appl. No. 16/709,538.
Application 16/709,538 is a continuation of application No. 16/282,393, filed on Feb. 22, 2019.
Application 16/282,393 is a continuation of application No. 15/917,968, filed on Mar. 12, 2018, granted, now 10,221,419, issued on Mar. 5, 2019.
Application 15/917,968 is a continuation of application No. 15/057,480, filed on Mar. 1, 2016, granted, now 9,914,926, issued on Mar. 13, 2018.
Application 15/057,480 is a continuation of application No. 14/487,221, filed on Sep. 16, 2014, granted, now 9,279,124, issued on Mar. 8, 2016.
Application 14/487,221 is a continuation of application No. 13/553,155, filed on Jul. 19, 2012, granted, now 8,853,181, issued on Oct. 7, 2014.
Claims priority of provisional application 61/510,172, filed on Jul. 21, 2011.
Prior Publication US 2020/0140870 A1, May 7, 2020
This patent is subject to a terminal disclaimer.
Int. Cl. C12N 15/113 (2010.01); A61K 31/713 (2006.01); A61K 9/00 (2006.01); A61K 9/06 (2006.01); A61K 9/127 (2006.01); A61K 31/7105 (2006.01)
CPC C12N 15/1137 (2013.01) [A61K 9/0014 (2013.01); A61K 9/06 (2013.01); A61K 9/127 (2013.01); A61K 31/713 (2013.01); A61K 31/7105 (2013.01); C12N 15/113 (2013.01); C12N 2310/14 (2013.01); C12N 2320/30 (2013.01)] 22 Claims
 
1. A nucleic acid molecule that is complementary to an mRNA sequence encoding a fidgetin-like 2 protein, wherein the nucleic acid molecule is double-stranded, is 22-56 nucleotides in length, and comprises a sequence selected from the group consisting of:
  (SEQ ID NO: 3)
  Sense: UUACACAGUAUUAAAGCGAUU
  and
   
  (SEQ ID NO: 4)
  Antisense: 5′ UCGCUUUAAUACUGUGUAAUU;
   
  (SEQ ID NO: 5)
  Sense: CAUCUGAAACCUAGGGUCUUU
  and
   
  (SEQ ID NO: 6)
  Antisense: 5′ AGACCCUAGGUUUCAGAUGUU;
   
  (SEQ ID NO: 7)
  Sense: GUGACUUAUGCUAGGAGGAUU
  and
   
  (SEQ ID NO: 8)
  Antisense: 5′UCCUCCUAGCAUAAGUCACUU;
   
  (SEQ ID NO: 9)
  Sense: GGUCAGAAGCAGAAUGUAUUU
  and
   
  (SEQ ID NO: 10)
  Antisense: 5′ AUACAUUCUGCUUCUGACCUU.