US 10,889,814 B2
Monocarboxylate transporter 4 (MCT4) antisense oligonucleotide (ASO) inhibitors for use as therapeutics in the treatment of cancer
Yuzhuo Wang, Vancouver (CA); and Stephen Yiu Chuen Choi, Vancouver (CA)
Assigned to The University of British Columbia
Appl. No. 15/779,419
Filed by THE UNIVERSITY OF BRITISH COLUMBIA, Vancouver (CA)
PCT Filed Nov. 30, 2016, PCT No. PCT/CA2016/000296
§ 371(c)(1), (2) Date May 25, 2018,
PCT Pub. No. WO2017/091885, PCT Pub. Date Jun. 8, 2017.
Claims priority of provisional application 62/260,837, filed on Nov. 30, 2015.
Prior Publication US 2019/0010492 A1, Jan. 10, 2019
Int. Cl. C12N 15/11 (2006.01); C12N 15/113 (2010.01); A61K 31/7088 (2006.01); C07H 21/04 (2006.01); A61K 31/713 (2006.01); A61P 35/00 (2006.01); A61K 31/337 (2006.01)
CPC C12N 15/113 (2013.01) [A61K 31/337 (2013.01); A61K 31/7088 (2013.01); A61K 31/713 (2013.01); A61P 35/00 (2018.01); C07H 21/04 (2013.01); C12N 2310/11 (2013.01); C12N 2310/14 (2013.01); C12N 2310/321 (2013.01); C12N 2310/341 (2013.01); C12N 2320/31 (2013.01)] 53 Claims
 
1. An antisense oligonucleotide (ASO), wherein the ASO has a sequence selected from the following:
(SEQ ID NO: 1)
(a) TCCCATGGCCAGGAGGGTTG;
 
(SEQ ID NO: 2)
(b) GTCCCGGAAGACGCTCAGGT;
 
(SEQ ID NO: 3)
(c) AAGGACGCAGCCACCATGCC;
 
(SEQ ID NO: 4)
(d) TTGGCGTAGCTCACCACGAA;
 
(SEQ ID NO: 5)
(e) AGATGCAGAAGACCACGAGG;
 
(SEQ ID NO: 6)
(f) CCACTCTGGAATGACACGGT;
 
(SEQ ID NO: 7)
(g) GTAGGAGAAGCCAGTGATGAC;
 
(SEQ ID NO: 8)
(h) AGCATGGCCAGCAGGATGGA;
 
(SEQ ID NO: 9)
(i) GGCTGGAAGTTGAGTGCCAA;
 
(SEQ ID NO: 10)
(j) CATGCCGTAGGAGATGCCAA;
 
(SEQ ID NO: 11)
(k) CTCAGGCTGTGGCTCTTTGG;
 
(SEQ ID NO: 13)
(l) AGCACGGCCCAGCCCCAGCC;
 
(SEQ ID NO: 14)
(m) GAGCTCCTTGAAGAAGACACT;
 
(SEQ ID NO: 15)
(n) CAGGATGGAGGAGATCCAGG;
 
(SEQ ID NO: 16)
(o) AGACCCCCCACAAGCATGAC;
 
(SEQ ID NO: 17)
(p) GAAGTTGAGTGCCAAACCCAA;
 
(SEQ ID NO: 18)
(q) CCCGTTGGCCATGGGGCGCC;
 
(SEQ ID NO: 19)
(r) GCCAGCCCGTTGGCCATGGG;
 
(SEQ ID NO: 20)
(s) AGGAAGACAGGGCTACCTGC;
 
(SEQ ID NO: 21)
(t) GCACACAGGAAGACAGGGCT;
 
(SEQ ID NO: 22)
(u) CAGGGCACACAGGAAGACAG;
 
(SEQ ID NO: 23)
(v) CAGCAGTTGAGCAGCAGGCC;
 
(SEQ ID NO: 46)
(w) ATGGCCAGGAGGGTTG;
 
(SEQ ID NO: 47)
(x) CATGGCCAGGAGGGTT;
 
(SEQ ID NO: 48)
(y) CCATGGCCAGGAGGGT; and
 
(SEQ ID NO: 49)
(z) CCCATGGCCAGGAGGG;
 
and wherein the ASO comprises a modified internucleoside linkage, a modified sugar moiety, or modified nucleobase, and wherein the ASO is not longer than 21 nucleotides in length.