CPC C07K 14/70521 (2013.01) [A61K 39/4611 (2023.05); A61K 39/4631 (2023.05); A61K 39/464406 (2023.05); A61K 39/464412 (2023.05); A61K 39/464471 (2023.05); C07K 14/7051 (2013.01); C07K 14/70578 (2013.01); C07K 16/2803 (2013.01); C07K 16/3061 (2013.01); C07K 16/3084 (2013.01); C07K 16/32 (2013.01); C12N 5/0638 (2013.01); C12N 15/1137 (2013.01); C07K 2317/622 (2013.01); C07K 2317/92 (2013.01); C07K 2319/03 (2013.01); C12N 2310/14 (2013.01)] | 8 Claims |
1. Isolated T cells comprising a nucleic acid molecule encoding a chimeric antigen receptor, wherein said T cells comprise at least one inhibitory nucleic acid molecule for CBL and at least one inhibitory nucleic acid molecule for CBL-B, and wherein the expression of CBL and CBL-B is inhibited in said T cells,
wherein said inhibitory nucleic acid molecule for CBL and said inhibitory nucleic acid molecule for CBL-B are selected from the group consisting of antisense, siRNA, shRNA, and miRNA,
wherein said chimeric antigen receptor comprises SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 6,
wherein said inhibitory nucleic acid molecule for CBL comprises or is complementary to a nucleotide sequence selected from the group consisting of AGCAGCTAGTATGTTTTATTAT (SEQ ID NO: 11), TCAGTGGTTCCAAGATTTCAA (SEQ ID NO: 12), and GGCGAAACCTAACCAAACT (SEQ ID NO: 13):
wherein said inhibitory nucleic acid molecule for CBL-B comprises or is complementary to a nucleotide sequence selected from the group consisting of: AGGTGAAAATGTCAAAACTAA (SEQ ID NO: 16), CAGTGAGAATGAGTACTTTA (SEQ ID NO: 17), and GACCATACCTCATAACAAG (SEQ ID NO: 18).
|