	US 11,717,530 B2
	Blockade of miR4661-3p binding to IL-17A mRNA with site-specific target site blocker prevents neuro-inflammatory-mediated disease
Jeffrey Bender, Orange, CT (US); Vinod Ramgolam, New Haven, CT (US); and Timur Yarovinsky, Woodbridge, CT (US)
Assigned to YALE UNIVERSITY, New Haven, CT (US)
Appl. No. 17/52,916
Filed by YALE UNIVERSITY, New Haven, CT (US)
PCT Filed May 7, 2019, PCT No. PCT/US2019/031098 § 371(c)(1), (2) Date Nov. 4, 2020, PCT Pub. No. WO2019/217407, PCT Pub. Date Nov. 14, 2019.
Claims priority of provisional application 62/667,763, filed on May 7, 2018.
Prior Publication US 2021/0069233 A1, Mar. 11, 2021
Int. Cl. C07H 21/04 (2006.01); A61K 31/7125 (2006.01); A61P 21/00 (2006.01); C12N 15/113 (2010.01)

CPC A61K 31/7125 (2013.01) [A61P 21/00 (2018.01); C12N 15/113 (2013.01)]

6 Claims

1. A method of treating an IL-17A mediated disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition comprising:

a polyribonucleic acid encoded by a deoxyribonucleic acid comprising the sequence set forth in SEQ ID NO: 4 (ACTTAAACATAAATAGATCCT),

wherein the polyribonucleic acid comprises at least one modification selected from the group consisting of locked nucleic acid, bridged nucleic acid, phosphorothioate nucleic acid and peptide nucleic acid.