US 11,865,134 B2
Treatment of inflammation with glucocorticoids and angiopoietin-like 7 (ANGPTL7) inhibitors
Gaurang Patel, Tarrytown, NY (US); Ying Hu, Tarrytown, NY (US); Kavita Praveen, Tarrytown, NY (US); Giovanni Coppola, Tarrytown, NY (US); Goncalo Abecasis, Tarrytown, NY (US); Aris Baras, Tarrytown, NY (US); and Carmelo Romano, Tarrytown, NY (US)
Assigned to Regeneron Pharmaceuticals, Inc., Tarrytown, NY (US)
Filed by Regeneron Pharmaceuticals, Inc., Tarrytown, NY (US)
Filed on Feb. 23, 2022, as Appl. No. 17/678,792.
Claims priority of provisional application 63/287,187, filed on Dec. 8, 2021.
Claims priority of provisional application 63/251,175, filed on Oct. 1, 2021.
Claims priority of provisional application 63/171,218, filed on Apr. 6, 2021.
Claims priority of provisional application 63/154,576, filed on Feb. 26, 2021.
Prior Publication US 2022/0370489 A1, Nov. 24, 2022
Int. Cl. C07H 21/02 (2006.01); C07H 21/04 (2006.01); A61K 31/713 (2006.01); A61P 27/06 (2006.01); A61K 45/06 (2006.01); C12Q 1/6883 (2018.01)
CPC A61K 31/713 (2013.01) [A61K 45/06 (2013.01); A61P 27/06 (2018.01); C12Q 1/6883 (2013.01); C12Q 2600/156 (2013.01)] 3 Claims
 
1. A method of treating a subject having rheumatoid arthritis, Graves' disease, or ophthalmic inflammation, the method comprising administering an Angiopoietin-Like 7 (ANGPTL7) inhibitor and a glucocorticoid to the subject, wherein:
the ANGPTL7 inhibitor is a double stranded ribonucleic acid (dsRNA) inhibitory nucleic acid molecule for inhibiting expression of ANGPTL7; and
the dsRNA inhibitory nucleic acid molecule comprises a sense strand and an antisense strand forming a double stranded region; and
the sense strand comprises a nucleotide sequence comprising AGACAGUAUAAGCAAGGGUUA (SEQ ID NO:5555) and wherein the antisense strand comprises a nucleotide sequence comprising UAACCCUUGCUUAUACUGUCUCC (SEQ ID NO:5556); and/or
the sense strand comprises a nucleotide sequence comprising ACACUUCCUUGUGUCUAUAGA (SEQ ID NO:5533) and wherein the antisense strand comprises a nucleotide sequence comprising UCUAUAGACACAAGGAAGUGUCG (SEQ ID NO:5534).