CPC A61K 31/713 (2013.01) [A61K 45/06 (2013.01); A61P 27/06 (2018.01); C12Q 1/6883 (2013.01); C12Q 2600/156 (2013.01)] | 3 Claims |
1. A method of treating a subject having rheumatoid arthritis, Graves' disease, or ophthalmic inflammation, the method comprising administering an Angiopoietin-Like 7 (ANGPTL7) inhibitor and a glucocorticoid to the subject, wherein:
the ANGPTL7 inhibitor is a double stranded ribonucleic acid (dsRNA) inhibitory nucleic acid molecule for inhibiting expression of ANGPTL7; and
the dsRNA inhibitory nucleic acid molecule comprises a sense strand and an antisense strand forming a double stranded region; and
the sense strand comprises a nucleotide sequence comprising AGACAGUAUAAGCAAGGGUUA (SEQ ID NO:5555) and wherein the antisense strand comprises a nucleotide sequence comprising UAACCCUUGCUUAUACUGUCUCC (SEQ ID NO:5556); and/or
the sense strand comprises a nucleotide sequence comprising ACACUUCCUUGUGUCUAUAGA (SEQ ID NO:5533) and wherein the antisense strand comprises a nucleotide sequence comprising UCUAUAGACACAAGGAAGUGUCG (SEQ ID NO:5534).
|